PCR primer checker: test Tm, GC clamp, hairpins and dimers before you order

Guide · Updated 2026-11-10

What each primer design rule means, how the three melting temperature formulas work, how to check a pair on a template, and a worked example with a primer that fails.

Open the Primer checker Free, in your browser, nothing uploaded.

The primer checker looks at one PCR primer, or a forward and reverse pair, and tells you whether it breaks any of the usual design rules: length, GC content, melting temperature, the bases at its 3′ end, runs of one letter, hairpins and primer-dimers. Paste a template too and it finds where each primer lands and how long the product will be. It is for students planning a first PCR and anyone checking an order sheet. Find a target region first with the DNA sequence tools, see where the primers fall on your vector in the plasmid map, and when the pair passes, make up the reaction with the PCR master mix.

What it is

PCR (the polymerase chain reaction) copies one stretch of DNA millions of times. Two short single strands, the primers, stick to its two ends, and the polymerase enzyme extends each from its 3′ end, where new bases are added.

Melting temperature (Tm) is the temperature at which half the primer has let go of its target. The tool gives three estimates. With N the length in bases and G+C the number of G and C bases:

• Wallace rule: Tm = 2 × (A+T) + 4 × (G+C), meant for very short oligos.
• Basic formula: Tm = 64.9 + 41 × (G+C − 16.4) ÷ N. This is the one in the summary.
• Salt-adjusted: Tm = 81.5 + 16.6 × log₁₀[Na⁺] + 0.41 × %GC − 675 ÷ N, with sodium in mol/L.

All three ignore the order of the bases, so they are only a guide.

The other checks:

• GC clamp: G or C bases among the last five at the 3′ end. One to three help the end grip; more can make it stick in the wrong places.
• Runs and repeats: four of one base, or a repeated pair like TGTG, can make the primer slip.
• Hairpin: the primer folding back and pairing with itself around a loop.
• Primer-dimer: two primers pairing with each other. The dangerous kind ends at a 3′ end, because the polymerase can extend it into a short junk product.

How to use it

1. Type the Forward primer 5′ to 3′, exactly as it will be ordered. Add the Reverse primer the same way, or leave it blank to check one primer.
2. Set Sodium (mM). Only the salt-adjusted Tm uses it.
3. To test binding, paste the target DNA into Template, choose Mismatches allowed (0, 1 or 2) and the Largest product (bp) to report.
4. Read the line at the top. Anything outside the usual range is counted there and marked “(check)” in the table.
5. Look at the Strongest primer-dimer drawing and, with a template, the list of sites and products.

A worked example

Take a made-up pair:

• Forward: CTGTCTTGACCGTGACGCAT
• Reverse: CGGGCTTGTGGTTACAGCAT

Both are 20 nt with 11 G or C, so GC is 11 ÷ 20 = 55 %.

Basic Tm: 64.9 + 41 × (11 − 16.4) ÷ 20 = 64.9 − 11.07 = 53.8 °C for each.

Wallace: 2 × 9 + 4 × 11 = 62 °C. Salt-adjusted at 50 mM: 81.5 + 16.6 × log₁₀(0.05) + 0.41 × 55 − 675 ÷ 20 = 81.5 − 21.60 + 22.55 − 33.75 = 48.7 °C. The formulas disagree by 13 °C, which is why they are only estimates.

Other checks. The 3′ clamps are 3 G or C (CGCAT) and 2 (AGCAT). The longest run is GGG, below the limit of four. Hairpin stems are 3 bp, self-dimers 3 bp with 2 at the 3′ end, and the cross-dimer 4 bp with 2 at a 3′ end. Nothing is flagged. The suggested annealing start is 53.8 − 5 = 48.8 °C.

On a template. Paste this made-up 400-base template:

CAGTGAGCGTACGCATTGTCCACATGCTGAAGCGCTGCATCTGTCTTGACCGTGACGCATATGCAGACGCGAATCAGTTAGAATGCCTAAAGTAGCGTCTTCTAACAGTACAAAACCAGCTATCGAAGATCACCCCGGCTCTTAAGGCCGGGCCTCCGTTTCCACTCTCCCTTCTATAATGCTATAGAGTCGGTGCCTTCAACTAAATATGTGGTTGGGGCCGGCCAGCCGTCGTTTCACAAGTTAGTAACATGGTATGGGCGCATTGCTAGAGGGAGTATGTCTGAGAAACAGACGGCCTCGATTGGCTGACCCTTGAGAAGATCCATGATGCTGTAACCACAAGCCCGATGGCTGTCATCCGACCACCCGGGAGACCTCCGAAAACACGACCACCAAA

The forward primer binds at 41–60 on the + strand and the reverse at 331–350 on the − strand, both with no mismatches. The product runs from base 41 to 350: 350 − 41 + 1 = 310 bp, the only one. The top line reads “Pair looks good: Tm 53.8 / 53.8 °C, 310 bp product”.

Now break it. Add GC to the end of the forward primer: CTGTCTTGACCGTGACGCATGC. It is now 22 nt with 13 G or C (59.1 %), and its basic Tm rises to 58.6 °C. Its last six bases, GCATGC, read the same on both strands, so two copies pair with each other right at their 3′ ends: a 6 bp self-dimer, all 6 at the 3′ end, which is flagged. Keep the original.

Where it is used

• Cloning and genotyping. Every PCR starts with a primer pair, and a quick check saves a re-order.
• Teaching labs. Change one base and watch a flag appear.
• qPCR assays. Short products and dimer-free primers matter even more when a dye reads every double strand; analyse the run afterwards with the qPCR analyser.
• Reusing published primers. Paste them with your own template to confirm they still match your strain or construct.

Common mistakes

• Typing the reverse primer as its complement. Enter it exactly as ordered, 5′ to 3′. The tool works out which strand it binds.
• Taking the formula Tm as the annealing temperature. Start from your polymerase supplier’s calculator and fine-tune with a gradient PCR.
• Ignoring where a dimer sits. A 4 bp match in the middle is rarely a problem; 3 bp at the 3′ end can be.
• Allowing too few mismatches when checking specificity. With 0 allowed you only see perfect sites. Try 2 to catch near-matches that might also prime.

Questions people ask

What product size should I aim for? For ordinary PCR, a few hundred to a couple of thousand bp is easy to see on a gel; qPCR products are usually much shorter, around 70 to 200 bp.

Why does the tool demand a matching 3′ end? The polymerase starts there. A mismatch near the 3′ end stops extension far more than one near the 5′ end, so the search treats the last three bases as fixed.